Skip to Main Content

Template DNA

Starting with the correct concentration of template DNA is critical to getting good sequencing data. Below is the nanogram amount of DNA needed for each sequencing reaction based on the type of DNA you are sequencing.

All samples need to be diluted in water to a total volume of 5uL.

PCR Product

Size (bp)

ng in Total

5uL Volume

100-500 1-5
500-1000 5-15
1000-1500 15-25
>2000 25-40
Plasmid DNA 100-250

 

 

Universal Primers Available

We provide the following universal primers for DNA sequencing.

If you would like us to add these to your samples, it must be specified on the Job Request Form.

PRIMERSEQUENCE
M13F (-40) GTTTTCCCAGTCACGAC
M13R CAGGAAACAGCTATGAC
T7 TAATACGACTCACTATAGGG
T3 ATTAACCCTCACTAAAGGG
SP6 TATTTAGGTGACACTATAG
SP6R TATAGTGTCACCTAAAT
T7R TATAGTGAGTCGTATTA
T7 Term. GCTAGTTATTGCTCAGCGG
8F AGAGTTTGATCCTGGCTCAG
907R CCGTCAATTCCTTTRAGTTT
704F GTAGCGGTGAAATGCGTAGA
1492R GGTTACCTTGTTACGACTT
M13F (-20) GTAAAACGACGGCCAGT
M13R (-48) AGCGGATAACAATTTCACA
PUC Univ. GGCTGGCTTAACTAT

 

IDAHO STATE UNIVERSITY

921 South 8th Avenue
Pocatello, Idaho, 83209
(208) 282-4636

Discover opportunity at Idaho State University